Define where the pipeline should find input data and save output data.

Path to comma-separated file containing information about the samples in the experiment.

required
type: string
pattern: ^\S+\.csv$

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Save all intermediate files (e.g. fastq, bams) of all steps of the pipeline to output directory

type: boolean

Options for processing reads with unique molecular identifiers

Enable UMI-based read deduplication.

type: boolean

UMI pattern to use. Can be either ‘string’ (default) or ‘regex’.

type: string
default: string

UMI grouping method

type: string
default: dir

Skip the UMI extraction from the reads before deduplication. Please note, if this parameter is set to false, the reads will be deduplicated solely on insert sequence. UMIs might be extracted after deduplication depending on the set umitools_bc_pattern nevertheless if with_umi is set to True.

type: boolean
default: true

The UMI barcode pattern to use e.g. ‘NNNNNN’ indicates that the first 6 nucleotides of the read are from the UMI.

type: string

After UMI barcode extraction discard either R1 or R2 by setting this parameter to 1 or 2, respectively.

type: integer

If this option is specified, intermediate FastQ and BAM files produced by UMI-tools are also saved in the results directory.

type: boolean

Reference genome related files and options required for the workflow.

Name of iGenomes reference.

type: string

Boolean whether MirGeneDB should be used instead of miRBase

type: boolean

Species for miRTrace.

type: string

Species of MirGeneDB.

type: string

Path to FASTA genome file.

type: string
pattern: ^\S+\.fn?a(sta)?(\.gz)?$

GFF/GTF file with coordinates positions of precursor and miRNAs.

type: string

GFF/GTF file with coordinates positions of precursor and miRNAs.

type: string

Path to FASTA file with mature miRNAs.

type: string
default: https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa

Path to FASTA file with MirGeneDB mature miRNAs.

type: string

Path to FASTA file with miRNAs precursors.

type: string
default: https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa

Path to FASTA file with miRNAs precursors.

type: string

Path to a Bowtie 1 index directory

type: string

Save generated reference genome files to results.

type: boolean

Directory / URL base for iGenomes references.

type: string
default: s3://ngi-igenomes/igenomes/

Do not load the iGenomes reference config.

hidden
type: boolean

Options for trimming reads and primers.

The number of basepairs to remove from the 5’ end of read 1.

type: integer

The number of basepairs to remove from the 3’ end of read 1 AFTER adapter/quality trimming has been performed.

type: integer

Sequencing adapter sequence to use for trimming.

type: string
default: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Trim FastQ files

type: boolean
default: true

Minimum filter length for raw reads.

type: integer
default: 17

Maximum filter length for raw reads.

type: integer
default: 100

Save reads failing trimming

type: boolean

Fasta with known miRNA adapter sequences for adapter trimming

type: string
default: ${projectDir}/assets/known_adapters.fa

Minimum number of reads required in input file to use it

type: integer
default: 10

Save merged reads.

type: boolean

The PHRED quality offset to be used for any input fastq files. Default is 33, standard Illumina 1.8+ format.

type: integer
default: 33

Options to remove contamination from the reads.

Enables the contamination filtering.

type: boolean

Path to the rRNA fasta file to be used as contamination database.

type: string

Path to the tRNA fasta file to be used as contamination database.

type: string

Path to the cDNA fasta file to be used as contamination database.

type: string

Path to the ncRNA fasta file to be used as contamination database.

type: string

Path to the piRNA fasta file to be used as contamination database.

type: string

Path to an additional fasta file to be used as contamination database.

type: string

Switches to skip specific pipeline steps, if desired.

Skip FastQC

type: boolean

Skip miRDeep

type: boolean

Skip MultiQC

type: boolean

Skip FastP

type: boolean

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Less common options for the pipeline, typically set in a config file.

Display version and exit.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

Email address for completion summary, only when pipeline fails.

hidden
type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Do not use coloured log outputs.

hidden
type: boolean

Custom config file to supply to MultiQC.

hidden
type: string

Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file

hidden
type: string

Custom MultiQC yaml file containing HTML including a methods description.

type: string

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Base URL or local path to location of pipeline test dataset files

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/test-datasets/

Suffix to add to the trace report filename. Default is the date and time in the format yyyy-MM-dd_HH-mm-ss.

hidden
type: string

Display the help message.

type: boolean,string

Display the full detailed help message.

type: boolean

Display hidden parameters in the help message (only works when —help or —help_full are provided).

type: boolean